JEFFERY TAUBENBERGER, VIRUS HUNTER, goes to work in a bland building overlooking I-270 in Rockville. It's the Armed Forces Institute of Pathology, and it is scheduled to be "disestablished" as part of the broader plan to close military bases around the country. Taubenberger doesn't know for sure what he'll be doing in a year or so. For now, he's still walking past the fluttering flags every day, down a flight of steps to a windowless office, where he's trying to save the world from a mysterious germ.
Doom and Gloom Talk Will Be Limited to 30 Minutes Daily, reads a sign on his bookshelf. I ask if that's a reference to the avian flu. No, he says, that's about the base closings.
The office is small and cluttered, with multiple stacks of documents, suggesting a man who is struggling to impose order on an overly busy life. His phone keeps ringing -- everyone wants a piece of him. You can't pick up a newspaper without seeing a story about the possible plague of avian flu, also known as bird flu or, to be scientifically correct, influenza A/H5N1. Millions could die, the stories say. Or tens of millions. Or hundreds of millions. Avian flu has reached a cultural and media tipping point, a kind of celebrity as the premier biological menace to civilization.
Avian flu is certainly a frightening virus. It kills birds, can infect human beings and has been lethal in about half of the documented cases so far in Asia and Indonesia. More than 60 people have died already. But so far it hasn't become easily transmissible from one human to another, unlike the common influenza virus that circulates every winter. Avian flu is still just that -- a bird flu, not a human flu. Every article about this flu has a boilerplate paragraph, as if mandated by law, stating that scientists fear the virus will mutate, become highly contagious in humans, and create a pandemic that will rival the catastrophe of the Spanish influenza of 1918.
Taubenberger is doing his part to keep that from happening. He wants to understand the various types of flu viruses at the most essential level -- tunneling deep into their genetic mysteries. What kind of mutation could turn avian flu into a pandemic pathogen? What genetic improvisations in these little nodules of RNA and protein -- these things so small and spare they hardly deserve the grandiose label of "microbe" -- can turn an ordinary flu into a cold-blooded killer?
He'll pause at some point to get a flu shot. "I'm susceptible to respiratory infections," he says. Taubenberger is something of an alpha nerd. Modest of stature, rather boyish at 44, quick of speech, he keeps on his desk a prop from his 10th-grade science fair project at Robert E. Lee High School in Springfield, the one that merited the grand prize for Fairfax County. It's a homemade model of the double helix, the structure of the DNA molecule. When discussing the genome of the flu virus, he will touch parts of the double helix and give a quick lecture on how life works: The adenine always binds to the thymine, the guanine to the cytosine . . .
The only flu in the room, as far as anyone can tell, is on a shelf. It's a stuffed, fuzzy influenza virus with plastic eyeballs,
a joke flu from a company called Giant Microbes. It's just a blob. That's scientifically accurate, because flu virus has an unremarkable appearance. In an electron microscope, you see a knobby little ball.
The effects of flu are more dramatic. Taubenberger keeps autopsy samples of lung tissue from a soldier who died of the 1918 virus. These are thin sections of lung, cut and stained, and preserved in paraffin on a glass slide. He puts a slide under his microscope. First we look at healthy tissue: Clearly visible are the air sacs, ready to breathe, with a scattering of red blood cells. Then we look at diseased tissue. They're filled, completely choked, with little red circles. Blood cells.
"You don't see any open air sacs anywhere. They're all filled with blood. This person drowned in his own blood," Taubenberger says. "This is not good, to use a highly technical medical term."
The 1918 flu killed more people in a short period of time than any other plague in human history. Taubenberger and his scientific collaborators hope that the virus will serve as a Rosetta stone for understanding avian flu. They have literally rebuilt the 1918 virus and brought it back to life. Taubenberger has come to the conclusion that there was something very weird about this germ. It was a bird flu that jumped to humans, but the fine print of its genetic code is noticeably different from that of other bird flus.
As he works on the mystery, one thing is clear: This is a scientific drama that involves not only disease but also evolution, the process by which organisms mutate and adapt to changing conditions. And it's evolution in real time, at a frantic pace, happening as we speak, here at the start of the flu season. There is much debate these days about whether evolution explains life on Earth, but in the real world, on the ground, among living things, evolution is not only real -- it's dangerous.
A Long War
MAN VS. MICROBE IS AN OLD NARRATIVE. The plot's been twisting. A few decades ago, medical science sensed that it had the germs in full retreat. Antibiotics saved lives once lost to the most routine infections. It's hard to remember, but people used to die of strep throat, a small cut, a hacking cough gone bad. Vaccines turned the tide; germs stopped killing babies in their cribs; smallpox disappeared outright.
And then the tide turned back. Drug-resistant bacteria began flourishing. HIV became pandemic. Scientists began talking of "emerging" diseases. They come from the rain forest, from the dark recesses of tropical caves, from foul duck ponds and fetid chicken coops. They take advantage of a world of abundant human and animal meat. It would appear from the unfolding concern over avian flu, and from recent outbreaks of panic over other pathogens -- SARS, for example -- that civilization is increasingly vulnerable to pandemics, and that the human face of the future will be covered with a mask.
By overcrowding the planet, by ravaging our environment, by jetting promiscuously around the world with all manner of microbes in tow, by overprescribing antibiotics and helping breed superbugs, we've set ourselves up for a plague. That's the basic argument.
But here's another possibility: That we're at a turning point in the war between people and germs. That we've learned, just in the past half-century or so, how to read the code of life. That we've
developed techniques, just in the past two decades, to discern the complete genetic code of an organism. That, just in the last few years, we've started to figure out the innermost secrets of microbes and what turns some of them into pathogens.
Jeffrey Gordon, who studies intestinal bacteria at Washington University in St. Louis, says: "We have the tools in the year 2005 to define the genetic evolution of a lot of these pathogens, particularly in the case of viruses like flu. It's a race between our society, our politics, our societal will and the viruses."
No one knows how the race will turn out, but the advantage at the moment is not necessarily on the side of the microbes. We're on to their game. Or, to use a more appropriate metaphor, we're not a bunch of sitting ducks.
The Secret of Life
TAUBENBERGER BECAME INSPIRED in 1995 by a story of human eyeballs floating in a jar. They belonged to John Dalton, the pioneering chemist. Dalton died in 1844, but his eyeballs stuck around. He was colorblind, and he saw his defective vision as an experiment waiting to happen.
He hypothesized that a fluid in the eye (the vitreous humor) would, upon close examination, prove to be blue, filtering out the normal hues. He instructed his assistant to pluck out his eyes upon his death. After the great man died, the assistant examined one of the eyes and saw no blue fluid. He nicked the other one in the rear and looked through it -- literally looked at the world through John Dalton's eye. The world appeared normal. The colorblindness was thus neurological, a problem rooted in Dalton's brain.
In 1995, researchers reported that they had taken the Dalton case a step further. Genetic testing -- a relatively new analytical tool unthinkable in the day of Dalton -- showed that he had an inherited colorblindness gene.
Taubenberger loved that. How very cool, he thought, to solve an old mystery through some aging tissue sitting in someone's lab. "Everything about life is interesting, when you start to get into the details of how things work," he says. Taubenberger, the head of the molecular pathology department at his institute, wondered: What could I do that would be really nifty, but also of significance to the world? A mentor once told him, "Work on an important problem."
He considered studying the yellow fever that killed so many people in the 1800s. But then he seized upon the Spanish influenza of 1918. It was wildly infectious, and virtually everyone on the planet was exposed. About 2.5 percent of those who became sick died, which seems like a modest level of lethality until you realize that it added up to more than 600,000 American deaths in just a matter of months and something like 40 million deaths worldwide. Taubenberger knew that the institute had millions of autopsy specimens from soldiers dating to the Civil War. If he could retrieve even a few genetic scraps of that virus, perhaps he could figure out why it was so contagious and virulent.
Ten years later, his project is still going, centered in the rather ordinary laboratory directly next to his office (he has collaborators in labs around the country). Taubenberger doesn't do a lot of bench work these days, what with giving interviews, taking meetings, trying to get things published, but he has assistants busily at work, filling tiny vials with fluids containing DNA, sequencing genes, tapping on computers, accessing databanks and doing all the highly detailed work of decoding the 1918 influenza virus. Taubenberger also has a new project in collaboration with the National Institutes of Health and a nearby genomics institute, to find the genetic codes of many thousands of different strains of viruses harvested from people and wild birds.
The overarching goal for both projects is to learn how these viruses evolve and which mutations might make them more or less likely to become adapted to humans and develop into potential killers. By removing from influenza some of its element of surprise, we might be able to forecast likely outbreaks, in the same way that we can forecast which tropical depression is going to turn into a hurricane. It's a sweeping plan, using all the hardware Taubenberger can round up.
If you take a left out of his lab, go through another lab (more vials, bottles, jars, tubes, refrigerators) and cross another hallway, you'll reach the room with the automated sequencers. There's a big one from Applied Biosystems, the 3132 Genetic Analyzer. Somehow, this thing can read the language of a genome, letter by letter.
Life on Earth operates on a genetic system that, at its core, is remarkably simple, considering that it gives rise to creatures as diverse as sea urchins, praying mantises and humans. The genome is written out on a very, very long molecule called deoxyribonucleic acid -- DNA.
Molecular biology is to some extent the study of architecture. It's all about structure. Proteins -- which do most of the heavy lifting in the body, such as building cells and tissues -- have many ways of folding themselves in three dimensions. Their structure determines their function. They roam the body in search of a correctly shaped receptor. They just want to fit in somewhere.
When Francis Crick and James Watson rocked the scientific world in 1953, it wasn't by discovering DNA. Rather, they found the structure of the molecule, and proved that it was the source of genetic information. "We've found the secret of life," Crick exulted that winter day to friends at the Eagle pub in Cambridge, England, and the secret, it turned out, wasn't some special juice, some exotic energy source, but just a well-framed, two-stranded, ladderlike molecule with rungs in all the right places and a nifty ability to make copies of itself.
A gene is historically defined as a segment of DNA with instructions for making a single protein, though the one-gene, one-protein rule is pretty loose. Humans have upwards of 30,000 genes. The flu virus has just 11.
The code of a gene is written in the form of tiny chemicals called nucleotides, more commonly referred to as the "bases" or "letters" of the genome. Life uses a very short alphabet. There are only four bases used by living things: adenine, cytosine, guanine and thymine, or A, C, G and T.
DNA sequencing, the process of finding the order of the letters, isn't terribly new. As far back as 1977, Fred Sanger and colleagues managed to piece together all 5,386 letters of a tiny organism called phi-X174. In the mid-1980s, Kary Mullis developed a technique still used in Taubenberger's lab, called polymerase chain reaction, which amplifies pieces of DNA and makes them easier to study.
Automated sequencing machines came online only in the past decade or so. They're like reverse vending machines. You open a door, place a tray of DNA samples in a slot, watch it recede into the interior of the machine, and wait. Inside the machine, needles descend into the DNA vials and pull the fluid through a tiny glass tube, known as a fiber-optic capillary. The machine examines the thin stream of fluid with laser light; the nucleotides, the bases, go slipping through the laser beam one by one, guanines glowing differently from cytosines, and so on. Soon, the results flash on an adjacent computer screen: the letters. The code. The process is hardly push-button simple -- the machines can examine only short segments of genes at one time, and scientists are often working with scraps to begin with. But it's definitely a scientific marvel.
"There's this kind of voodoo part," Taubenberger says. "Nothing you do can be seen. It's all invisible. It's all magic." But, he adds, in homage to the requirements of the scientific method, "it's reproducible magic."
Resurrecting a Killer
FINDING THE FIRST SCRAPS of the 1918 virus took a full year. Any flu virus is tricky to recover, because it tends to vanish under the onslaught of the body's immune system. In many cases the 1918 victims died of secondary bacterial pneumonia that flared in their ravaged lung tissues.
Taubenberger and his assistants searched scores of autopsy samples and finally came across one from a soldier who died at Fort Jackson, S.C., with pneumonia in just one lung. Taubenberger had a hunch: The soldier would have died with live, intact virus still in his "healthy" lung. Sure enough, in tissue from that healthy lung he found, and painstakingly recovered, remnants of the 1918 virus.
Then he got more of the virus from an unexpected source. After he published a paper in the journal Science in 1997 reporting his initial results, he received a call from an elderly pathologist named Johan Hultin. Hultin knew where to find bodies of native Alaskans who had died of the virus and were still preserved in the permafrost of Alaska. What happened next has been oft-told in recent years: Hultin returned to Alaska and, hacking into the frozen ground, found the corpse of a woman whose tissues preserved the killer virus. Eventually, Taubenberger teased out the entire genome.
Then came something unimaginable even a decade ago: Taubenberger, Terrence Tumpey of the federal Centers for Disease Control and Prevention, and their collaborators brought the 1918 virus back to life. Or more precisely, they re-manufactured it. They followed the genetic recipe and cooked it up.
The procedure involved a technique developed in 1999 called reverse genetics. Scientists can synthesize stretches of DNA, putting the chemical bases in a desired order. Genes can then be converted into a useful chunk called a plasmid and inserted into a cell culture. If all goes well, and if the scientists have stamped This End Up in all the right places, the virus will reassemble itself inside the cell.
Tumpey and his colleagues took antiviral medication and wore protective hoods as they rebuilt the virus in Atlanta. They actually made a number of variations of the 1918 virus. Some viruses had a few of the 1918 genes. One version had all the genes. The scientists infected mice with the different strains, and the strain with all the genes proved by far the most lethal, quickly killing all the infected mice.
This fall, the scientists published the genome and their test results in the journals Nature and Science. One syndicated columnist declared that we had just given our terrorist enemies a lethal weapon. It's certainly true that mad scientists could conceivably re-create the 1918 pathogen and combine it with some kind of warhead. Back in the day, the Soviets were enthusiastic about putting biological agents such as anthrax into their missiles.
But the 1918 virus wouldn't be the ideal bioweapon. Flu strains currently in circulation are descendants of that virus, so people carry some immunity to that subtype of flu. There are biological agents, such as anthrax, that would be easier to obtain, easier to weaponize.
The upside of publication is clear. Scientists can try to figure out where the 1918 germ came from and what made it so lethal. The paper in Science stated that all 11 genes, contained in eight gene segments, play a role in making an "exceptionally virulent virus" in the mice. To Taubenberger, that suggests that bird flu viruses need a small number of mutations on each gene, possibly in a certain order, to reach the elite level of a 1918-style killer. He thinks perhaps 25 mutations all told are necessary. He bases this on what appear to be some common mutations that differentiate human flus such as 1918 from ordinary bird flus. Alarmingly, strains of avian flu in Asia already show some of these mutations on four of the eight gene segments. On the three genes necessary for viral replication, for example, some avian flu strains already have two of what Taubenberger believes are 10 mutations common in human flus. "I am moderately worried," he says. "We don't know exactly what the rules are."
Sure, bad guys might somehow figure out how to use the published data about the 1918 virus to invent a new version of flu that can kill lots of people. But a simpler scenario is that Mother Nature will do it by herself.
She's got a bigger lab.
A Planet of Germs
GERMS COME IN MANY FORMS, from viruses to bacteria to protozoa to fungi, and we prejudicially lump them into a group called microorganisms, or "microbes," as though being a bulky, fleshy hunk of animated meat is the norm for life on Earth. But the microbes had dominion over the planet long before there were any humans, and they'll surely be here when we're gone.
"We're vastly outnumbered," says Ira Longini, a biostatistics professor at Emory University in Atlanta. "The microbial world is infinitely larger than we are. Much more varied, much more flexible. We virtually swim in it."
Although Anton van Leeuwenhoek developed the microscope in the 1600s and observed tiny "animalcules," no one could imagine that such humble organisms could bring a strong man to his knees, make skin burst into pustules and boils and lesions, cause wounds to putrefy and lungs to fill with blood. People assumed that illness came from the inhalation of noxious vapors, or as punishment for sins, or from the malign schemes of evil spirits.
The English doctor Edward Jenner noticed in 1796 that milkmaids sometimes caught a disease called cowpox. He showed that infected fluid from a milkmaid's hand, injected in another person, would provide partial immunity to the related disease of smallpox. But he had no idea that pox came from a tiny entity that would someday be called a "virus."
Medical science, so advanced today, was a primitive field compared with such noble endeavors as engineering and physics. But gradually, a germ theory of disease began to form. Englishman John Snow in the 1850s made careful observations of a cholera outbreak in London, plotting the location of the sick and dying, and eventually tracked the epidemic to a single contaminated well. Surgeons discovered that if they washed their hands their patients had a better chance of survival. Louis Pasteur argued that microorganisms caused not only fermentation but also any number of human diseases. In 1876, the German physician Robert Koch showed that anthrax came from a bacterium. One by one, science linked diseases to microorganisms. But viruses were hard to nail down. They were too small to see.
The 1918 pandemic was all the more terrifying for being so mysterious. Flu mortality by age group normally shows a bathtub-shaped curve, killing primarily young children and the very old, but the 1918 germ had a W-shaped curve, with a huge spike among healthy people in their twenties. Many were soldiers in military camps and troop transport ships. This seemed almost a medieval disease, wildly contagious, capable of killing its victims within two days. The lungs filled with a thick bloody fluid. A doctor at Camp Devens, near Boston, wrote of the dying soldiers, "Two hours after admission they have the Mahogany spots over the cheek bones, and a few hours later you can begin to see the Cyanosis extending from their ears and spreading all over the face, until it is hard to distinguish the coloured men from the white."
There were rumors that this pestilence was nothing less than the Black Death, the bubonic plague of the 14th century. When the disease spread to Philadelphia, there were not enough caskets, and bodies lay rotting in the slums, in hallways and on porches. The corpses were stacked by the hundreds at the city morgue. The pathogen swept the country, targeting crowded military installations, where the sick and dying overflowed hospitals and jammed every corridor, surrounded by bloody sheets, vomit, urine, feces and buzzing flies. At Camp Grant, in Illinois, more than 500 soldiers died, and the commander finally put a bullet through his brain. The explosive nature of the disease mimicked the behavior of the virus itself, replicating by the thousands in an individual cell, and bursting forth to run riot all over the lungs. Not until 1930 did scientists manage to isolate an influenza virus.
The horrors of World War II, and the search for cures for infections, helped usher in a glorious era in microbiology. A scientist named Alexander Fleming had made the fortuitous discovery that bacteria in his lab died in the presence of bread mold, leading to the invention of penicillin and other antibiotics. And, although agents that killed viruses weren't just sitting around in nature waiting to be discovered, scientists were able to develop vaccines for polio, measles and other childhood diseases.
Still, viruses were enigmatic. It took many decades, well into the 1970s, for science to grasp what these things were and to understand their diabolical genius.
A virus is arguably not truly alive. A virus cannot replicate or evolve unless it is inside a host. It's a parasite, hijacking the host's cellular machinery. For example, the flu virus when inhaled infects the upper respiratory tract (though the 1918 virus went deep into the lungs). The virus penetrates a cell, inserts its own genetic game plan and forces the cell to make copies of more virus. Cells can die in the process, and others can be killed by the host's immune system as it desperately tries to wipe out the invaders. Bacteria set up shop among the slaughtered cells. Death can often follow from this secondary bacterial pneumonia.
Modern medicine struggles to attack viruses, because they're so deeply insinuated into cells. It took the advent of recombinant DNA, the techniques of splicing and dicing genes, for medical science to produce the first antivirals, which don't kill viruses outright but suppress their ability to replicate.
When isolated, outside a cell, a virus is a biological zero. It has no metabolism, processes no energy and might hang together for just a day before falling apart.
Viruses are made of either DNA or RNA, the two genetic molecules of Earth life. There's not much else to them. You might describe them as data in search of an argument. The virologist Peter Jahrling has a sign in his office saying, "A virus is just a piece of bad news wrapped in a protein." Taubenberger likes an automotive analogy: "You can think of them as very streamlined life forms, like race cars. They don't have any extraneous stuff."
The success of viruses implies that the fundament of life is not liquid water, or carbon molecules, or some mysterious essence, but rather information.
Deeper Into the Code
TAUBENBERGER THINKS ABOUT LETTERS. TGG. CAG. TAC. AAA. These are the DNA bases, tripled up, forming what's called a codon, the instructions for an amino acid. Put enough amino acids together, and you've got a working protein. A single copying error during viral replication, an A becoming a G, can change an amino acid, alter the structure of the protein and perhaps change the way the virus behaves.
So Taubenberger has letters on his mind. He calls them up on his computer screen and prints them out, eight separate pages, a page for each influenza gene segment.
What's the message -- no, the music -- in those letters?
Music and genetics are both important to him. Like many scientists and mathematicians, he composes music in his spare time. Chamber music. Symphonies. He wrote a comic opera in college, at George Mason University. He used to play the oboe. Music and the genetic code, he says, "both rely on a stable kind of alphabet in a sense. There are only so many notes available, and there are 12 different tones. All music" -- he later stipulates that he's talking about Western music -- "whether it's Bach or rock-and-roll, it's all using selected combinations of those 12 tones."
Right there is the genius of life on Earth.
"There's an infinite way to arrange the genetic code. Here it is, it's only four different letters, and it makes things as different as flu viruses and oak trees and fruit flies and fruit bats."
Influenza is tiny. It's made out of RNA, the smaller, one-stranded cousin of DNA. A human being has a genome with about 3 billion letters, but a flu virus has just 13,500. Here, converted by scientific custom into the alphabet of DNA, are the first of the 1,681 letters that code for the protein hemagglutinin in the 1918 flu virus:
atggaggcaagactactggtcttgttatgt . . .
Wait, it gets better. Check this out, from the middle of the gene:
. . . ggggtctatttggagccattgccggttttattgaggggggatgg . . .
Perhaps it looks like gibberish at first glance. Also second glance. Even Taubenberger says, in a burst of honesty, "It's very hard to know where the meaning is."
But he sees patterns. All genes start with the codon ATG, which corresponds to the amino acid methionine; all genes stop with one of three codons that effectively shout, "Halt!" There's some slop in the system: There are 64 possible codons of the four letters, but only 20 amino acids are used by Earth life. This means several different three-letter combinations will sometimes lead to the same amino acid. Biologists, perhaps ungenerously, call the code "degenerate" because of this imprecision.
By studying these letters, Taubenberger has already decided that, among flu viruses, 1918 is strange. Down at the level of the GGC and ATA and CCT and TTT and so on, it just isn't like any of the bird flus currently in circulation. Could the differences be caused by bird flus evolving dramatically between 1918 and today? Taubenberger went to the Smithsonian and said, in essence, I need an old bird. A curator produced a carefully preserved brant goose, collected in Alaska in 1917. Taubenberger found a remnant of bird flu in the goose, studied it in his lab, and saw that it wasn't that different from contemporary bird flus. Samples of other birds circa World War I led to a firm conclusion: The Spanish influenza wasn't like the wild bird flus then circulating.
"It came from a donor host that we don't know about," he speculates.
A strange bird, never studied by virologists, perhaps. An odd duck. Or perhaps some of the 1918 virus's evolutionary history took place not only inside a bird but also within an entirely different sort of animal -- a mystery mammal.
The hemagglutinin protein is of particular interest, because it's on the surface of the virus, and it determines whether the virus will bind to a cell or keep swimming past. Because it sticks up on the outside of the virus, it's the target of the immune system's antibodies. A simple mutation can cause the hemagglutinin to change structure and suddenly be less recognizable to the antibodies that patrol for flu viruses.
Flu evolves at a breakneck pace, because it makes so many copying errors as it replicates. A CGT could become, for example, a CCT, changing one amino acid in the resulting protein. Chances are, that won't do the virus any good. Most mutations are deleterious. But every so often a copying mistake will lead to a virus that replicates faster, or can penetrate more deeply into the lungs, or can colonize the cells of a different animal.
Which mutations should we fear most? Taubenberger doesn't know.
"We don't know anything!" he says.
A Coming Plague?
HE'S EXAGGERATING. HE KNOWS A LOT. But probably the least appreciated and most important phrase in science is "We don't know." Uncertainty is built into the fabric of science. It keeps scientists humble. Sometimes it can make them sound a little dodgy. You can talk to scientists until the cows come home and never hear a completely definitive statement. Everything is hedged, preliminary, subject to revision. Scientists are uncomfortable with absolutes in a universe built on perplexing relativistic principles and spooky quantum mechanics. Even the constants of nature, like gravity, are now viewed as a little squishy around the edges.
If you ask Taubenberger a big, thorny question, he'll likely say, "The answer is 42." It's a reference to the signature irony in The Hitchhiker's Guide to the Galaxy, and the narrator's quest to find the meaning of life. Taubenberger responded to one overly broad biology question by saying, "I'll give you a highly technical answer: We don't know."
Everyone has the same question about avian flu: How worried should we be? The short answer (other than "nobody knows") is that, although it's a nasty virus, it would be premature to cancel plans for the rest of one's life. It's not time to go into survivalist mode, living off canned food and wearing a hepa-filter mask 24 hours a day.
When digesting stories about avian flu, one should remember that the media love a good End Is Near tale. Doom is good for ratings. The most alarmist voices invariably will be the most quoted. One network stated in prime time that a billion people could die of this flu -- yes, billion with a "b." Some of the experts sounding the most dire alarms may be on a quest for funding. One expert told a group of congressional staffers this fall that when the pandemic strikes, "time will be described, for those left living, as before and after the pandemic." Except that wasn't true after the pandemics of 1957 and 1968, and it wasn't true even after 1918. The Spanish influenza was so overshadowed by World War I that historian Alfred Crosby wrote a book about it called America's Forgotten Pandemic.
No doubt, the H5N1 strain (the H stands for hemagglutinin, the N for neuraminidase) is the most worrisome type of wild bird flu, because it has already shown that it can infect people and kill them. And each person it infects is a kind of petri dish for further mutation. If a person who already has a human flu is simultaneously infected with a bird flu, the two strains can "reassort" into a new flu that has the worst qualities of the original two. Or the bird and human viruses could reassort inside a pig. Researchers have heard tales of farmers feeding bird-flu-infected chickens to pigs.
All these animals in all these places represent yet more petri dishes. For this reason, "avian flu" is already an oversimplified term. The avian flu of the newspaper headlines, H5N1, has led to countless mutant strains. Viruses don't break down easily into distinct species. Rather, they're like a cloud, a mist of slightly different genetic entities, that blows across the landscape. The H5N1 strain catalogued as A/Vietnam/HN30408/05 is not exactly the same as the one called A/Vietnam/JPHN30321/05 or A/Duck/GuangXi/13/2004.
We also don't know what would happen to the virulence -- the deadliness -- of the avian flu if it did become a human contagion. Contagiousness and virulence are often at cross-purposes. Ebola, a frightening filament-like virus that causes uncontrolled bleeding throughout the victim's body, burns so hot as a disease that it usually kills people before they have much of a chance to spread it. Emerging viruses that are initially highly lethal, such as avian flu in the human cases seen so far, often evolve toward lower virulence for their own survival. Even the merciless 1918 virus evolved into a milder strain. Jahrling, the virologist, says: "The equilibrium seems to be toward lower virulence, toward an accommodation with the host. It's not smart to kill your host."
What does Jahrling think will happen in the case of avian flu?
"We can't prognosticate evolution," he says.
We can keep our eyes open. If, based on genetic flu research like Taubenberger's, scientists knew exactly which mutations were critical to the emergence of a pandemic strain of flu, and if health officials carefully monitored the strains evolving in the influenza hot spots of Southeast Asia, China and Indonesia, it might be possible to snuff out a dangerous strain before it could spread.
The U.S. government has to prepare for the worst, even at the risk of later being accused of overreacting. The Department of Health and Human Services, on November 1, issued its long-awaited pandemic influenza plan. President Bush, trying to recover from the Katrina fiasco, went to the National Institutes of Health to unveil the plan and, in effect, declare war on flu. He asked Congress to spend $2.8 billion to make vaccine production faster. He asked for $1.2 billion to stockpile an avian flu vaccine that is still in trials. He asked for another billion to stockpile antiviral drugs such as Tamiflu and Relenza. Bush said Americans can't wait for the microbial terrorists to come here, but rather must attack them where they originate. "Our country has been given fair warning of this danger to our homeland, and time to prepare," Bush said.
He'd run up a $7 billion tab in just a few paragraphs, but no one in the crowd, all leaders of the Disease Industry, was going to protest. (The germs themselves have no lobbyists.) The plan has run into some budgetary and political troubles, but the broader problem may be scientific and technological. Vaccines aren't magic bullets. Influenza, like HIV, is a moving target. This year's avian flu vaccine may not do any good in a couple of years. There are limits to our ability to force the natural world to conform to our schedules and projected budgets for the next fiscal year. Pandemics, like earthquakes and hurricanes, don't obey our dictates.
The H5N1 virus surfaced in humans in 1997, when it killed a 3-year-old child in Hong Kong. The flu experts sounded the alarm. Pandemic possible. No one has immunity. This could be the Big One. Then H5N1 receded from view. Robert Webster, perhaps the leading researcher on avian flu, told an audience soon thereafter, "If this virus had learned to spread from human to human, at least half of you would not be in this room today."
Eight years later, all the alarms are going off again. The virus reemerged in 2003 in southern China. It has devastated poultry farmers. Carried by migrating birds, the virus has spread westward across the Eurasian landmass, to Europe. In the United States, poultry farms have become high-security zones. And now winter is here. Flu season.
If one wants to be optimistic, one can consider that avian flu has had abundant opportunity in recent years to mutate or reassort into a pandemic human virus. Does it need more time? Or is there some biological barrier that it can't surmount?
"If it's going to do this, why hasn't it happened already?" Taubenberger asks.
There are at least 16 subtypes of bird flu, based on differences in the hemagglutinin protein coat. The subtypes are called H1, H2, H3 and so on, but the numbers are just convenient labels; an H2 flu doesn't have twice as much hemagglutinin as H1. We don't know how many of the 16 subtypes of bird flu are capable of jumping species and causing human flu pandemics, but it appears that the five most recent pandemics -- 1850, 1890, 1918, 1957 and 1968 -- were caused by just three subtypes (H1, H2, and H3). Could it be that those are the only three subtypes capable of causing flu pandemics?
We don't know.
If there's one certainty, it's that germs are a growth industry. When Richard Krause took over the National Institute of Allergy and Infectious Diseases in 1975, it ranked only eighth in funding among the various institutes of NIH, he recalls.
"We didn't get much funding because people no longer thought infectious diseases were important. Follow the money. If you want to know what the public thinks is important, follow the money," says Krause, who stepped down as director in 1984.
Many of the people who study pathogens have a new headquarters, or a new laboratory, or a new vaccine plant, or some other shiny piece of infrastructure. The infectious organisms themselves are nothing to look at -- microbiology as a science involves lots of tiny vials holding clear, colorless liquids -- but the buildings (the structures!) are increasingly impressive.
At the Centers for Disease Control and Prevention in Atlanta, the new security entrance leads to the new garage, the new visitor center and two new high-rise buildings jammed with offices and laboratories. Go to Fort Detrick in Frederick, where the Army has, for years, studied scary microbes in a drab, aging facility, and you'll learn of a new building going up under the auspices of NIAID. Just south of town, NIAID also has a new $65 million vaccine pilot plant tucked into an industrial park.
Perhaps what's truly different today is not that we're more vulnerable to disease, but that we're less tolerant of it. The idea of a loved one being swept away by a pestilence is unthinkable. We're eager to pay for protection against microbes. And we know that, even if H5N1 doesn't turn pandemic, some other flu strain could, and there are other germs out there, lurking, biding their time, evolving. The list is long and scary: HIV. Monkey pox. Ebola. Marburg. Dengue hemorrhagic fever. Lyme. Chronic wasting disease. Drug-resistant staph and strep. And there are diseases that don't even have names -- bacteria and viruses that doctors have never seen before.
In addition to remembering to wash their hands, Americans should realize that they're in a relatively privileged position, with access to health care and medication that's rare in much of the world. Countless people on the planet suffer from rather mundane but totally treatable and curable diseases. The leading killer worldwide of children is diarrhea caused by parasites. Those children don't need a new vaccine; they need clean water.
Most people in America aren't worried about TB, or malaria, or measles, or diarrheal diseases, because they don't know anyone who's dying of them.
Steven Holland, a physician who treats infectious diseases at NIH, says, "It's like most things: All politics is local, and all infectious disease is local."
Fighting the Mutant Swarm
ON THE NIH CAMPUS, MICROBIOLOGIST Kanta Subbarao has three candidates for an avian flu vaccine already in the pipeline. But she wants vaccines that might be useful against any of the 16 subtypes of flu. For example, she worries that an H9 flu virus could become pandemic. It's not very virulent in humans at the moment, but it's all over the place, and it could reassort into something more lethal. So add that to the list, next to the H5 subtypes: the threat of H9.
Also H7.
"There was a large outbreak in 2003 in poultry in the Netherlands," she reports. Several people who handled infected birds caught the H7 flu themselves, and one died. Then H7 vanished.
That's the nature of viruses that lurk in animal reservoirs. One reason we don't worry about a natural outbreak of smallpox is that it's an entirely human virus. It hasn't merely retreated, it has gone extinct in the wild. This is not the case with influenza, or with, to take the example of something that Subbarao has in her lab, the SARS virus. It put a scare in the world three years ago and killed about 800 people, but since has vanished. SARS turned out to be a public health triumph -- officials were able to quarantine infected people before the pathogen could become pandemic. No one ever figured out where SARS came from. Civet cats, maybe? Bats? Is it still out there, somewhere?
There is so much we don't know.
"The more you know," says Dave Evers, one of Taubenberger's postdoctoral fellows, "the more you know that you don't know."
Taubenberger wants more data. More code. "Maybe we're not doing enough," he says. "We need lots more sequences to help understand the significance of what's happening with H5." He wants to look at human flu viruses, pig flu viruses, horse flu viruses, everything out there.
As he talks about this, he appears a bit fatigued. It's so much work, breaking these codes. Just look at his desk already: too many papers, too many articles to read, too many printouts, all of it pushing up against that prop from his 10th-grade science project, that double helix, which looks simpler and more elegant by the minute.
"My life at work has basically spun a little bit out of control," the scientist says. "I live in barely contained chaos all the time."
But that's just life on Earth.
Joel Achenbach is a Magazine staff writer. He will be fielding questions and comments about this article Monday at 1 p.m. at washingtonpost.com/liveonline.
Can We Stop the Next Killer Flu?
